Transcript: Human NM_012212.3

Homo sapiens prostaglandin reductase 1 (PTGR1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-05-21
Taxon:
Homo sapiens (human)
Gene:
PTGR1 (22949)
Length:
1249
CDS:
104..1093

Additional Resources:

NCBI RefSeq record:
NM_012212.3
NBCI Gene record:
PTGR1 (22949)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_012212.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000221903 CTATCCTACTAATAGTGACTT pLKO.1 148 CDS 100% 4.950 6.930 N PTGR1 n/a
2 TRCN0000221901 CGTCTCCTGATGGTTATGATT pLKO.1 720 CDS 100% 5.625 3.938 N PTGR1 n/a
3 TRCN0000343529 CGTCTCCTGATGGTTATGATT pLKO_005 720 CDS 100% 5.625 3.938 N PTGR1 n/a
4 TRCN0000221904 CTTGGATTTGATGTCGTCTTT pLKO.1 656 CDS 100% 4.950 3.465 N PTGR1 n/a
5 TRCN0000343527 CTTGGATTTGATGTCGTCTTT pLKO_005 656 CDS 100% 4.950 3.465 N PTGR1 n/a
6 TRCN0000221905 GACTTGCTGAAATGGGTCTTA pLKO.1 959 CDS 100% 4.950 3.465 N PTGR1 n/a
7 TRCN0000343531 GACTTGCTGAAATGGGTCTTA pLKO_005 959 CDS 100% 4.950 3.465 N PTGR1 n/a
8 TRCN0000221902 GCCTACTTTGGCCTACTTGAA pLKO.1 488 CDS 100% 4.950 3.465 N PTGR1 n/a
9 TRCN0000352883 GCCTACTTTGGCCTACTTGAA pLKO_005 488 CDS 100% 4.950 3.465 N PTGR1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_012212.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.