Transcript: Human NM_013236.4

Homo sapiens ataxin 10 (ATXN10), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-26
Taxon:
Homo sapiens (human)
Gene:
ATXN10 (25814)
Length:
3294
CDS:
231..1658

Additional Resources:

NCBI RefSeq record:
NM_013236.4
NBCI Gene record:
ATXN10 (25814)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_013236.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000294371 TGACCCAGTGGGTGATATATG pLKO_005 1471 CDS 100% 13.200 18.480 N ATXN10 n/a
2 TRCN0000307307 TAGTAGAGTTTAACGTGTATA pLKO_005 1787 3UTR 100% 13.200 10.560 N ATXN10 n/a
3 TRCN0000084097 GCAGATGCATCCCTACTTAAA pLKO.1 1563 CDS 100% 13.200 9.240 N ATXN10 n/a
4 TRCN0000286966 GCAGATGCATCCCTACTTAAA pLKO_005 1563 CDS 100% 13.200 9.240 N ATXN10 n/a
5 TRCN0000084095 CCCAAACTGAACAATCAAGAA pLKO.1 936 CDS 100% 4.950 3.465 N ATXN10 n/a
6 TRCN0000287029 CCCAAACTGAACAATCAAGAA pLKO_005 936 CDS 100% 4.950 3.465 N ATXN10 n/a
7 TRCN0000084096 CCCAGGACTATCTTCCAAAGA pLKO.1 357 CDS 100% 4.950 3.465 N ATXN10 n/a
8 TRCN0000084093 CCTGTGCGAAATGACTGTGAA pLKO.1 1157 CDS 100% 4.950 3.465 N ATXN10 n/a
9 TRCN0000286965 CCTGTGCGAAATGACTGTGAA pLKO_005 1157 CDS 100% 4.950 3.465 N ATXN10 n/a
10 TRCN0000084094 GCAGTTAATAACAGAATGCTT pLKO.1 464 CDS 100% 3.000 2.100 N ATXN10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_013236.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.