Transcript: Human NM_013264.5

Homo sapiens DEAD-box helicase 25 (DDX25), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-06
Taxon:
Homo sapiens (human)
Gene:
DDX25 (29118)
Length:
7424
CDS:
11..1462

Additional Resources:

NCBI RefSeq record:
NM_013264.5
NBCI Gene record:
DDX25 (29118)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_013264.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000420346 GGATTTAATAGGCCATCTAAA pLKO_005 356 CDS 100% 13.200 18.480 N DDX25 n/a
2 TRCN0000422615 ACCCTAATGTTATCAAGTTAC pLKO_005 897 CDS 100% 10.800 15.120 N DDX25 n/a
3 TRCN0000150887 GACCACTTTAACAGCAGTATT pLKO.1 1391 CDS 100% 13.200 10.560 N DDX25 n/a
4 TRCN0000435769 TCAGATCATAGTATTCGTATT pLKO_005 785 CDS 100% 10.800 8.640 N DDX25 n/a
5 TRCN0000154424 GCAACATTTATGGCAGCATCA pLKO.1 999 CDS 100% 4.050 3.240 N DDX25 n/a
6 TRCN0000155503 CTGAACAACATCCGGCAATAT pLKO.1 935 CDS 100% 13.200 9.240 N DDX25 n/a
7 TRCN0000438407 GGATCCCAGCTCTCCACTTTA pLKO_005 271 CDS 100% 13.200 9.240 N DDX25 n/a
8 TRCN0000420428 TTTGTGCAGTATCCTAGTTTA pLKO_005 1479 3UTR 100% 13.200 9.240 N DDX25 n/a
9 TRCN0000420173 ACAGGAAAGACAGCGGCATTT pLKO_005 449 CDS 100% 10.800 7.560 N DDX25 n/a
10 TRCN0000154769 GCCTAGCTCCTACTTATGAAT pLKO.1 525 CDS 100% 5.625 3.938 N DDX25 n/a
11 TRCN0000157728 CGACGTGAAACTGTCACAGAT pLKO.1 1554 3UTR 100% 4.950 3.465 N DDX25 n/a
12 TRCN0000152333 GATGTGATGATTGACACTCAA pLKO.1 758 CDS 100% 4.950 3.465 N DDX25 n/a
13 TRCN0000155017 GCAGAGTTAATGCCTTGGAAT pLKO.1 486 CDS 100% 4.950 3.465 N DDX25 n/a
14 TRCN0000154556 GTGAACTTTGATCTCCCTGTA pLKO.1 1241 CDS 100% 4.050 2.835 N DDX25 n/a
15 TRCN0000157148 GTGAGAATGTCTCAGTGGGTT pLKO.1 1501 3UTR 100% 2.640 1.848 N DDX25 n/a
16 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 5385 3UTR 100% 5.625 2.813 Y KLHL30 n/a
17 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 5385 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_013264.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.