Transcript: Human NM_013265.4

Homo sapiens VPS51 subunit of GARP complex (VPS51), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
VPS51 (738)
Length:
2661
CDS:
38..2386

Additional Resources:

NCBI RefSeq record:
NM_013265.4
NBCI Gene record:
VPS51 (738)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_013265.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000156352 CCCGGAAGTTTACCTAGACAA pLKO.1 244 CDS 100% 4.950 6.930 N VPS51 n/a
2 TRCN0000156488 CCTGGTCATATCACAGATGCT pLKO.1 1789 CDS 100% 2.640 2.112 N VPS51 n/a
3 TRCN0000347382 CACGGGATGCTGAAGCTTTAC pLKO_005 137 CDS 100% 10.800 7.560 N Vps51 n/a
4 TRCN0000154172 CCGGAAGATGAAGAACGATTT pLKO.1 403 CDS 100% 10.800 7.560 N VPS51 n/a
5 TRCN0000343614 CCGGAAGATGAAGAACGATTT pLKO_005 403 CDS 100% 10.800 7.560 N VPS51 n/a
6 TRCN0000156252 CGGGATGCTGAAGCTTTACTA pLKO.1 139 CDS 100% 5.625 3.938 N VPS51 n/a
7 TRCN0000154002 CACTCTCACTGATGAACAGTT pLKO.1 1666 CDS 100% 4.950 3.465 N VPS51 n/a
8 TRCN0000152690 GAAGAACGATTTCCGGAAGAT pLKO.1 412 CDS 100% 4.950 3.465 N VPS51 n/a
9 TRCN0000151062 GAAGCTATTCTCTGAACGTAT pLKO.1 2074 CDS 100% 4.950 3.465 N VPS51 n/a
10 TRCN0000352888 GAAGCTATTCTCTGAACGTAT pLKO_005 2074 CDS 100% 4.950 3.465 N VPS51 n/a
11 TRCN0000156382 CAAGAGGACTTTCTCCGTGTA pLKO.1 1969 CDS 100% 4.050 2.835 N VPS51 n/a
12 TRCN0000343615 CAAGAGGACTTTCTCCGTGTA pLKO_005 1969 CDS 100% 4.050 2.835 N VPS51 n/a
13 TRCN0000157729 CAAAGAGGTGTCCTTCTCCAA pLKO.1 1444 CDS 100% 2.640 1.848 N VPS51 n/a
14 TRCN0000157603 GAACAGTTTCTGGTGCAGGAT pLKO.1 1679 CDS 100% 2.640 1.848 N VPS51 n/a
15 TRCN0000156899 GTGTTAGAGTTCACCGACCAT pLKO.1 935 CDS 100% 2.640 1.848 N VPS51 n/a
16 TRCN0000343672 GTGTTAGAGTTCACCGACCAT pLKO_005 935 CDS 100% 2.640 1.848 N VPS51 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_013265.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.