Transcript: Human NM_013437.4

Homo sapiens LDL receptor related protein 12 (LRP12), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-01
Taxon:
Homo sapiens (human)
Gene:
LRP12 (29967)
Length:
4149
CDS:
128..2707

Additional Resources:

NCBI RefSeq record:
NM_013437.4
NBCI Gene record:
LRP12 (29967)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_013437.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000350808 AGGGCTTAGACAACCATATAA pLKO_005 2539 CDS 100% 15.000 21.000 N LRP12 n/a
2 TRCN0000063409 CCAGGCGAAATCATTACTATA pLKO.1 377 CDS 100% 13.200 18.480 N LRP12 n/a
3 TRCN0000300991 CCAGGCGAAATCATTACTATA pLKO_005 377 CDS 100% 13.200 18.480 N LRP12 n/a
4 TRCN0000323228 CACAATTCCACCTCCGTATAT pLKO_005 499 CDS 100% 13.200 10.560 N LRP12 n/a
5 TRCN0000370569 ACTAGATGTTAAGGTTGTTAA pLKO_005 3121 3UTR 100% 13.200 9.240 N LRP12 n/a
6 TRCN0000323160 ATGTTAGCCTGCATGGTTAAA pLKO_005 2832 3UTR 100% 13.200 9.240 N LRP12 n/a
7 TRCN0000063410 CCAGGAAATTTCCATTGTAAA pLKO.1 1484 CDS 100% 13.200 9.240 N LRP12 n/a
8 TRCN0000063411 CCTGGAGTAAGGCCAAGTAAT pLKO.1 2570 CDS 100% 13.200 9.240 N LRP12 n/a
9 TRCN0000370639 CGAGCACCAAGTGGCATAATC pLKO_005 290 CDS 100% 13.200 9.240 N LRP12 n/a
10 TRCN0000063412 GCAGGCAGATCAAGCAACATT pLKO.1 1913 CDS 100% 5.625 3.938 N LRP12 n/a
11 TRCN0000063408 CCTCCGTATATCTCTTCACAA pLKO.1 509 CDS 100% 4.950 3.465 N LRP12 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_013437.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.