Transcript: Mouse NM_013485.1

Mus musculus complement component 9 (C9), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
C9 (12279)
Length:
1767
CDS:
30..1715

Additional Resources:

NCBI RefSeq record:
NM_013485.1
NBCI Gene record:
C9 (12279)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_013485.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000067477 CCATACCGATAGACTGCAGAA pLKO.1 175 CDS 100% 4.050 5.670 N C9 n/a
2 TRCN0000067474 CCTACAAACATTTCAGCTAAA pLKO.1 849 CDS 100% 10.800 8.640 N C9 n/a
3 TRCN0000067473 CCGAGAGAAGACCTCGAATTT pLKO.1 740 CDS 100% 13.200 9.240 N C9 n/a
4 TRCN0000067475 CCTTGCCTCAAACAAAGGTTT pLKO.1 228 CDS 100% 4.950 3.465 N C9 n/a
5 TRCN0000067476 GAGCAAGCAATTCTCCTGAAA pLKO.1 1377 CDS 100% 4.950 3.465 N C9 n/a
6 TRCN0000057192 GCAGGCTATGGGATCAACATT pLKO.1 528 CDS 100% 5.625 3.938 N C9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_013485.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.