Transcript: Mouse NM_013504.5

Mus musculus desmocollin 1 (Dsc1), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Dsc1 (13505)
Length:
5007
CDS:
218..2716

Additional Resources:

NCBI RefSeq record:
NM_013504.5
NBCI Gene record:
Dsc1 (13505)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_013504.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000094071 CGCCATACTTCACCCAAACTT pLKO.1 1269 CDS 100% 5.625 3.938 N Dsc1 n/a
2 TRCN0000094073 GCCTTACAATTTGTTCTACAT pLKO.1 757 CDS 100% 4.950 3.465 N Dsc1 n/a
3 TRCN0000094069 CCATATAACTATGAAGGCAAA pLKO.1 2784 3UTR 100% 4.050 2.835 N Dsc1 n/a
4 TRCN0000094072 CCAGATGATGTAGCTCAGCAA pLKO.1 2393 CDS 100% 2.640 1.848 N Dsc1 n/a
5 TRCN0000094070 CCAAATATAATCCTTGGGAAA pLKO.1 2270 CDS 100% 4.050 2.430 N Dsc1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_013504.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.