Transcript: Mouse NM_013527.1

Mus musculus growth differentiation factor 7 (Gdf7), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-16
Taxon:
Mus musculus (mouse)
Gene:
Gdf7 (238057)
Length:
1399
CDS:
22..1383

Additional Resources:

NCBI RefSeq record:
NM_013527.1
NBCI Gene record:
Gdf7 (238057)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_013527.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000068154 CCACTTCATGATGTCGCTTTA pLKO.1 276 CDS 100% 10.800 15.120 N Gdf7 n/a
2 TRCN0000431011 CCACTTCATGATGTCGCTTTA pLKO_005 276 CDS 100% 10.800 15.120 N GDF7 n/a
3 TRCN0000423770 GAGCTTCCTGTTCGACGTATC pLKO_005 393 CDS 100% 6.000 8.400 N Gdf7 n/a
4 TRCN0000436518 TACATCGATGCCGCCAACAAC pLKO_005 1309 CDS 100% 4.950 6.930 N Gdf7 n/a
5 TRCN0000068153 GCCATTAGACTACGAGGCATA pLKO.1 1137 CDS 100% 4.050 3.240 N Gdf7 n/a
6 TRCN0000443704 AGTCACTGCACGTGGACTTTA pLKO_005 1085 CDS 100% 13.200 9.240 N Gdf7 n/a
7 TRCN0000436142 CTACAAGCAGTACGAAGACAT pLKO_005 1335 CDS 100% 4.950 3.465 N Gdf7 n/a
8 TRCN0000068157 GAAGCCGATGAGGTGGTGAAT pLKO.1 424 CDS 100% 4.950 3.465 N Gdf7 n/a
9 TRCN0000068155 CGCAAAGGAAAGAGAGTCTGT pLKO.1 806 CDS 100% 2.640 1.848 N Gdf7 n/a
10 TRCN0000068156 CGACTGGATCATCGCGCCATT pLKO.1 1122 CDS 100% 1.350 0.945 N Gdf7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_013527.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.