Transcript: Mouse NM_013632.4

Mus musculus purine-nucleoside phosphorylase (Pnp), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Pnp (18950)
Length:
2941
CDS:
281..1150

Additional Resources:

NCBI RefSeq record:
NM_013632.4
NBCI Gene record:
Pnp (18950)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_013632.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000366919 CTTAGTTGCCTTCTCAAATTA pLKO_005 1320 3UTR 100% 15.000 12.000 N Pnp n/a
2 TRCN0000366921 CCTCCCACACTTGAGATATAT pLKO_005 1374 3UTR 100% 15.000 10.500 N Pnp n/a
3 TRCN0000366920 GACCAAAGATCAACCCAATAC pLKO_005 1464 3UTR 100% 10.800 7.560 N Pnp n/a
4 TRCN0000187928 GCCTTCAAACAGTACCTTCTA pLKO.1 1395 3UTR 100% 4.950 3.465 N Pnp n/a
5 TRCN0000376090 ACAAGGTTGTCATGGATTATG pLKO_005 1008 CDS 100% 13.200 7.920 N Pnp n/a
6 TRCN0000186871 GCTTCAGGATTCTAGCATATA pLKO.1 2335 3UTR 100% 13.200 7.920 N Pnp n/a
7 TRCN0000187995 GCACAGACATTGGAAAGGTTT pLKO.1 1082 CDS 100% 4.950 2.970 N Pnp n/a
8 TRCN0000193142 CTTCTGCAACACACTGAATAT pLKO.1 329 CDS 100% 13.200 6.600 Y Pnp n/a
9 TRCN0000376029 ACAATGAGATACCCAACTTTC pLKO_005 429 CDS 100% 10.800 5.400 Y Pnp n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_013632.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.