Transcript: Mouse NM_013732.7

Mus musculus CART prepropeptide (Cartpt), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Cartpt (27220)
Length:
875
CDS:
50..439

Additional Resources:

NCBI RefSeq record:
NM_013732.7
NBCI Gene record:
Cartpt (27220)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_013732.7, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000106622 CATTCCGATCTACGAGAAGAA pLKO.1 292 CDS 100% 4.950 6.930 N Cartpt n/a
2 TRCN0000106620 CGGTTCCCATATTCCCTCTTT pLKO.1 461 3UTR 100% 4.950 6.930 N Cartpt n/a
3 TRCN0000106621 CCCGAGGAACTTCCTGCAATT pLKO.1 396 CDS 100% 10.800 7.560 N Cartpt n/a
4 TRCN0000106624 CTGCAATTCTTTCCTCTTGAA pLKO.1 409 CDS 100% 4.950 3.465 N Cartpt n/a
5 TRCN0000106623 GAAGCTCAAGAGTAAACGCAT pLKO.1 274 CDS 100% 2.640 1.848 N Cartpt n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_013732.7, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02210 pDONR223 100% 83.4% 86.8% None (many diffs) n/a
2 ccsbBroad304_02210 pLX_304 0% 83.4% 86.8% V5 (many diffs) n/a
Download CSV