Transcript: Mouse NM_013733.3

Mus musculus chromatin assembly factor 1, subunit A (p150) (Chaf1a), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Chaf1a (27221)
Length:
3308
CDS:
97..2832

Additional Resources:

NCBI RefSeq record:
NM_013733.3
NBCI Gene record:
Chaf1a (27221)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_013733.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000295216 CCATGTGCATCACGCAGTTTA pLKO_005 2642 CDS 100% 13.200 10.560 N Chaf1a n/a
2 TRCN0000109039 CCAGTGAAGAGGTTAATACAA pLKO.1 166 CDS 100% 5.625 4.500 N Chaf1a n/a
3 TRCN0000109036 CGTAGGCTTGAGTACAAAGTT pLKO.1 333 CDS 100% 5.625 4.500 N Chaf1a n/a
4 TRCN0000287842 CGTAGGCTTGAGTACAAAGTT pLKO_005 333 CDS 100% 5.625 4.500 N Chaf1a n/a
5 TRCN0000295217 AGTACCGAGTGTGGTCATTAT pLKO_005 405 CDS 100% 13.200 9.240 N Chaf1a n/a
6 TRCN0000109035 CCTGGACAGCTACTTCCAAAT pLKO.1 3113 3UTR 100% 10.800 7.560 N Chaf1a n/a
7 TRCN0000298387 CCTGGACAGCTACTTCCAAAT pLKO_005 3113 3UTR 100% 10.800 7.560 N Chaf1a n/a
8 TRCN0000109038 CGGTGTGTCTGAAAGGAAGAA pLKO.1 1671 CDS 100% 4.950 3.465 N Chaf1a n/a
9 TRCN0000287841 CGGTGTGTCTGAAAGGAAGAA pLKO_005 1671 CDS 100% 4.950 3.465 N Chaf1a n/a
10 TRCN0000109037 GCTGCTACATGGCAATGTGAA pLKO.1 2256 CDS 100% 4.950 3.465 N Chaf1a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_013733.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.