Transcript: Mouse NM_013745.5

Mus musculus nuclear fragile X mental retardation protein interacting protein 1 (Nufip1), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Nufip1 (27275)
Length:
3974
CDS:
43..1497

Additional Resources:

NCBI RefSeq record:
NM_013745.5
NBCI Gene record:
Nufip1 (27275)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_013745.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000215332 CTCCGGTTACACATTCTTATT pLKO.1 431 CDS 100% 13.200 18.480 N Nufip1 n/a
2 TRCN0000240753 TTGCAGTGTGTTCGATATATC pLKO_005 1420 CDS 100% 13.200 18.480 N Nufip1 n/a
3 TRCN0000240752 TCCACGTACCACACGTCTTAC pLKO_005 406 CDS 100% 10.800 8.640 N Nufip1 n/a
4 TRCN0000175142 GCCGTAAAGGAAATGACTTTA pLKO.1 2156 3UTR 100% 1.320 1.056 N Nufip1 n/a
5 TRCN0000168255 CCAGTTCCATTGGAGAAATAT pLKO.1 654 CDS 100% 15.000 10.500 N NUFIP1 n/a
6 TRCN0000240754 GCTTGATTTAGCCAGATATAT pLKO_005 3080 3UTR 100% 15.000 10.500 N Nufip1 n/a
7 TRCN0000240755 ACCCAACTCTGGCCAATATTG pLKO_005 755 CDS 100% 13.200 9.240 N Nufip1 n/a
8 TRCN0000217234 CCAAGAACACATCACCCATAT pLKO.1 1348 CDS 100% 10.800 7.560 N Nufip1 n/a
9 TRCN0000240751 GAGCCACTGTCACCCATTATT pLKO_005 1323 CDS 100% 15.000 9.000 N Nufip1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_013745.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.