Transcript: Mouse NM_013752.3

Mus musculus nibrin (Nbn), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Nbn (27354)
Length:
2491
CDS:
108..2363

Additional Resources:

NCBI RefSeq record:
NM_013752.3
NBCI Gene record:
Nbn (27354)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_013752.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000273044 ATTTGTGGACGTCCAATTATA pLKO_005 603 CDS 100% 15.000 21.000 N Nbn n/a
2 TRCN0000273045 CAGATGAAATTCCTACATTAA pLKO_005 286 CDS 100% 13.200 9.240 N Nbn n/a
3 TRCN0000012670 CGGCAGTTAAAGTCACCATTA pLKO.1 565 CDS 100% 10.800 7.560 N Nbn n/a
4 TRCN0000012671 CGGAGATTGGATTGGCTGTTA pLKO.1 1030 CDS 100% 4.950 3.465 N Nbn n/a
5 TRCN0000350162 CGGAGATTGGATTGGCTGTTA pLKO_005 1030 CDS 100% 4.950 3.465 N Nbn n/a
6 TRCN0000012669 GCTGACTGAATTTAGGTCATT pLKO.1 2066 CDS 100% 4.950 3.465 N Nbn n/a
7 TRCN0000012668 AGCTGTAGAAACACATTTCTA pLKO.1 2381 3UTR 100% 0.563 0.394 N Nbn n/a
8 TRCN0000273047 AGCTGTAGAAACACATTTCTA pLKO_005 2381 3UTR 100% 0.563 0.394 N Nbn n/a
9 TRCN0000012672 GCAGTTCAAGTGAAGGTTGAA pLKO.1 1824 CDS 100% 0.495 0.347 N Nbn n/a
10 TRCN0000273046 GCAGTTCAAGTGAAGGTTGAA pLKO_005 1824 CDS 100% 0.495 0.347 N Nbn n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_013752.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.