Transcript: Mouse NM_013755.3

Mus musculus glycogenin (Gyg), mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Gyg (27357)
Length:
1736
CDS:
113..1114

Additional Resources:

NCBI RefSeq record:
NM_013755.3
NBCI Gene record:
Gyg (27357)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_013755.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000103086 CGGCATTTAAAGCGTTTGGTA pLKO.1 708 CDS 100% 3.000 2.400 N Gyg n/a
2 TRCN0000103089 CAGGGCCTACTGAATACATAT pLKO.1 602 CDS 100% 13.200 9.240 N Gyg n/a
3 TRCN0000103087 GCCGATTACATGGGAGCAGAT pLKO.1 1049 CDS 100% 4.050 2.835 N Gyg n/a
4 TRCN0000103088 GCAGCATTTCAATATACTCCT pLKO.1 681 CDS 100% 2.640 1.848 N Gyg n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_013755.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13868 pDONR223 100% 87.2% None (many diffs) n/a
2 ccsbBroad304_13868 pLX_304 0% 87.2% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV