Transcript: Mouse NM_013771.5

Mus musculus YME1-like 1 (S. cerevisiae) (Yme1l1), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Yme1l1 (27377)
Length:
4571
CDS:
195..2342

Additional Resources:

NCBI RefSeq record:
NM_013771.5
NBCI Gene record:
Yme1l1 (27377)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_013771.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000031203 GCTCACCAAGATGCATTTAAA pLKO.1 807 CDS 100% 15.000 10.500 N Yme1l1 n/a
2 TRCN0000326051 GCTCACCAAGATGCATTTAAA pLKO_005 807 CDS 100% 15.000 10.500 N Yme1l1 n/a
3 TRCN0000031200 CCTTGGATTATCTGAATTGAA pLKO.1 380 CDS 100% 5.625 3.938 N Yme1l1 n/a
4 TRCN0000326052 CCTTGGATTATCTGAATTGAA pLKO_005 380 CDS 100% 5.625 3.938 N Yme1l1 n/a
5 TRCN0000031201 GCAGTCTACCTCTGAAAGATT pLKO.1 674 CDS 100% 5.625 3.938 N Yme1l1 n/a
6 TRCN0000325980 GCAGTCTACCTCTGAAAGATT pLKO_005 674 CDS 100% 5.625 3.938 N Yme1l1 n/a
7 TRCN0000031202 CCTGAGAATGACAGATGGAAT pLKO.1 1923 CDS 100% 4.950 2.970 N Yme1l1 n/a
8 TRCN0000326054 CCTGAGAATGACAGATGGAAT pLKO_005 1923 CDS 100% 4.950 2.970 N Yme1l1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_013771.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.