Transcript: Mouse NM_013775.1

Mus musculus T cell leukemia/lymphoma 1B, 2 (Tcl1b2), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Tcl1b2 (27381)
Length:
1020
CDS:
58..411

Additional Resources:

NCBI RefSeq record:
NM_013775.1
NBCI Gene record:
Tcl1b2 (27381)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_013775.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000114132 GCTCCCTACAATCCCATGAAT pLKO.1 259 CDS 100% 5.625 7.875 N Tcl1b2 n/a
2 TRCN0000114134 GACGTGGAGATTAGCATCCAT pLKO.1 297 CDS 100% 3.000 4.200 N Tcl1b2 n/a
3 TRCN0000114135 CAATCCCATGAATTACAACTT pLKO.1 267 CDS 100% 4.950 3.960 N Tcl1b2 n/a
4 TRCN0000114133 CCACAAGTTCTGATCTCCACA pLKO.1 94 CDS 100% 2.640 1.848 N Tcl1b2 n/a
5 TRCN0000438005 GGTACAGATAGGGACTCTATG pLKO_005 768 3UTR 100% 10.800 5.400 Y Tcl1b5 n/a
6 TRCN0000114131 CCTCTGTTTGTTCCTCAAGTT pLKO.1 473 3UTR 100% 4.950 2.475 Y Tcl1b2 n/a
7 TRCN0000114136 GCTGGAGACAAACTGCATCTT pLKO.1 591 3UTR 100% 4.950 2.475 Y Tcl1b3 n/a
8 TRCN0000114116 CCTGACCTTATAGATGGCTTT pLKO.1 637 3UTR 100% 4.050 2.025 Y Tcl1b1 n/a
9 TRCN0000114126 CCCATTTACCTTAGGATGTAT pLKO.1 729 3UTR 100% 5.625 2.813 Y Tcl1b5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_013775.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.