Transcript: Mouse NM_013836.3

Mus musculus transcription factor 20 (Tcf20), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Tcf20 (21411)
Length:
7241
CDS:
186..6083

Additional Resources:

NCBI RefSeq record:
NM_013836.3
NBCI Gene record:
Tcf20 (21411)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_013836.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000085165 CGCTGTCTCATGTCTAGTGAT pLKO.1 3753 CDS 100% 4.950 6.930 N Tcf20 n/a
2 TRCN0000304548 CAGCAACAAGAGGAGTATAAA pLKO_005 3543 CDS 100% 15.000 10.500 N Tcf20 n/a
3 TRCN0000304546 GTAGCTCCAGTGGGCATATTG pLKO_005 4758 CDS 100% 13.200 9.240 N Tcf20 n/a
4 TRCN0000304547 TTGTTCCAATGACAATGAAAT pLKO_005 6472 3UTR 100% 13.200 9.240 N Tcf20 n/a
5 TRCN0000085163 CCACGAAATGTCAGTGGTTAT pLKO.1 2424 CDS 100% 10.800 7.560 N Tcf20 n/a
6 TRCN0000085166 CCCTCATCATCATCTAAGAAA pLKO.1 1734 CDS 100% 5.625 3.938 N Tcf20 n/a
7 TRCN0000301996 CCCTCATCATCATCTAAGAAA pLKO_005 1734 CDS 100% 5.625 3.938 N Tcf20 n/a
8 TRCN0000015492 GCACAGGCTTATGGAACACAA pLKO.1 1062 CDS 100% 4.950 3.465 N TCF20 n/a
9 TRCN0000297821 GCACAGGCTTATGGAACACAA pLKO_005 1062 CDS 100% 4.950 3.465 N TCF20 n/a
10 TRCN0000085167 GCTGAAGAGAAAGAGAACGAT pLKO.1 4800 CDS 100% 3.000 2.100 N Tcf20 n/a
11 TRCN0000301904 GCTGAAGAGAAAGAGAACGAT pLKO_005 4800 CDS 100% 3.000 2.100 N Tcf20 n/a
12 TRCN0000085164 CCACCAGAATTTCAGCCCTAT pLKO.1 1349 CDS 100% 4.050 2.430 N Tcf20 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_013836.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.