Transcript: Mouse NM_013875.6

Mus musculus phosphodiesterase 7B (Pde7b), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Pde7b (29863)
Length:
5106
CDS:
383..1723

Additional Resources:

NCBI RefSeq record:
NM_013875.6
NBCI Gene record:
Pde7b (29863)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_013875.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000114917 CCATTCATTGACTTCCGTCTA pLKO.1 521 CDS 100% 4.050 5.670 N Pde7b n/a
2 TRCN0000048916 CGATCTACAATTGGCATGCTT pLKO.1 1124 CDS 100% 3.000 4.200 N PDE7B n/a
3 TRCN0000114919 GTCTTGTTTGAGAGCCCTGAA pLKO.1 416 CDS 100% 4.050 3.240 N Pde7b n/a
4 TRCN0000114916 GCTCTCTGTTTCTCCTAATAA pLKO.1 3530 3UTR 100% 15.000 10.500 N Pde7b n/a
5 TRCN0000048917 CCTTGAAGTGTGCTGACATTT pLKO.1 1335 CDS 100% 13.200 9.240 N PDE7B n/a
6 TRCN0000433610 TGAGAGAAAGTACCTTCTATT pLKO_005 2142 3UTR 100% 13.200 9.240 N PDE7B n/a
7 TRCN0000415507 TTGTTTGATCGCTTGACAAAT pLKO_005 743 CDS 100% 13.200 9.240 N PDE7B n/a
8 TRCN0000114918 CCCTAGCATACAAATTGGTTT pLKO.1 1492 CDS 100% 4.950 3.465 N Pde7b n/a
9 TRCN0000114920 CGTCTACTTAACAATACAACA pLKO.1 536 CDS 100% 4.950 3.465 N Pde7b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_013875.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.