Transcript: Mouse NM_013882.2

Mus musculus G two S phase expressed protein 1 (Gtse1), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Gtse1 (29870)
Length:
2707
CDS:
126..2351

Additional Resources:

NCBI RefSeq record:
NM_013882.2
NBCI Gene record:
Gtse1 (29870)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_013882.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000089966 CATAATGAACACTCCAGACAT pLKO.1 2201 CDS 100% 4.950 6.930 N Gtse1 n/a
2 TRCN0000317472 CATAATGAACACTCCAGACAT pLKO_005 2201 CDS 100% 4.950 6.930 N Gtse1 n/a
3 TRCN0000313887 TTGGGCCTGTTGGACATAAAG pLKO_005 235 CDS 100% 13.200 10.560 N Gtse1 n/a
4 TRCN0000089964 GCTAAAGAAGACCCTGTTAAA pLKO.1 998 CDS 100% 13.200 9.240 N Gtse1 n/a
5 TRCN0000089965 CCAAAGTTCTCACGGACACAT pLKO.1 1521 CDS 100% 4.950 3.465 N Gtse1 n/a
6 TRCN0000089963 CCTCTGCTGTTGATTCTGTTT pLKO.1 2364 3UTR 100% 4.950 3.465 N Gtse1 n/a
7 TRCN0000317473 CCTCTGCTGTTGATTCTGTTT pLKO_005 2364 3UTR 100% 4.950 3.465 N Gtse1 n/a
8 TRCN0000313952 TACCACAACAAACCCATTTAA pLKO_005 1457 CDS 100% 0.000 0.000 N Gtse1 n/a
9 TRCN0000313954 CCGAGACACCTCAGTTGAATA pLKO_005 1378 CDS 100% 13.200 7.920 N Gtse1 n/a
10 TRCN0000089967 CTGTTGGACATAAAGAAAGAT pLKO.1 241 CDS 100% 5.625 3.375 N Gtse1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_013882.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.