Transcript: Mouse NM_013927.2

Mus musculus cyclic nucleotide gated channel beta 3 (Cngb3), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Cngb3 (30952)
Length:
4708
CDS:
84..2168

Additional Resources:

NCBI RefSeq record:
NM_013927.2
NBCI Gene record:
Cngb3 (30952)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_013927.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000068729 GCTCAACTAAATGGGTCTATA pLKO.1 1201 CDS 100% 13.200 18.480 N Cngb3 n/a
2 TRCN0000068731 GCCTGCATGGACCATATCATT pLKO.1 1428 CDS 100% 5.625 7.875 N Cngb3 n/a
3 TRCN0000429267 TATTGGGCAGTTCGAACTTTA pLKO_005 1254 CDS 100% 13.200 9.240 N CNGB3 n/a
4 TRCN0000068732 CCCACGGATTTGCCAATCTTT pLKO.1 1888 CDS 100% 5.625 3.938 N Cngb3 n/a
5 TRCN0000068728 CGGAGACAATTACCAAAGTTA pLKO.1 3863 3UTR 100% 5.625 3.938 N Cngb3 n/a
6 TRCN0000068730 CCAGTCAGCTTTAAGACCAAA pLKO.1 390 CDS 100% 4.950 3.465 N Cngb3 n/a
7 TRCN0000044229 CCTGGTGACTTTGTCTGCAAA pLKO.1 1698 CDS 100% 4.950 2.970 N CNGB3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_013927.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.