Transcript: Human NM_014004.2

Homo sapiens protocadherin gamma subfamily A, 8 (PCDHGA8), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-07-06
Taxon:
Homo sapiens (human)
Gene:
PCDHGA8 (9708)
Length:
3488
CDS:
899..3361

Additional Resources:

NCBI RefSeq record:
NM_014004.2
NBCI Gene record:
PCDHGA8 (9708)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_014004.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000056412 GCGGTGTCTGATAAATATTAA pLKO.1 1198 CDS 100% 15.000 21.000 N PCDHGA8 n/a
2 TRCN0000429416 ATTCGAGCCTTACACTCTATC pLKO_005 2955 CDS 100% 10.800 15.120 N PCDHGA8 n/a
3 TRCN0000056408 CGGGACAGTAATTGCCTTCTT pLKO.1 1984 CDS 100% 4.950 6.930 N PCDHGA8 n/a
4 TRCN0000421289 GGTCGAAGATCTAGAAGTAAA pLKO_005 1300 CDS 100% 13.200 9.240 N PCDHGA8 n/a
5 TRCN0000454986 GAAGTGATCATTACGTCTTTG pLKO_005 1934 CDS 100% 10.800 7.560 N PCDHGA8 n/a
6 TRCN0000056411 CCGTTATTCCAGCTTAATGAA pLKO.1 1766 CDS 100% 5.625 3.938 N PCDHGA8 n/a
7 TRCN0000056410 GTTTAGTTCTTTGCTTGCTTT pLKO.1 3327 CDS 100% 4.950 3.465 N PCDHGA8 n/a
8 TRCN0000056409 CGTGACAGTGTTGGATACAAA pLKO.1 1585 CDS 100% 5.625 3.375 N PCDHGA8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_014004.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.