Transcript: Human NM_014139.3

Homo sapiens sodium voltage-gated channel alpha subunit 11 (SCN11A), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-30
Taxon:
Homo sapiens (human)
Gene:
SCN11A (11280)
Length:
6505
CDS:
200..5575

Additional Resources:

NCBI RefSeq record:
NM_014139.3
NBCI Gene record:
SCN11A (11280)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_014139.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000413086 GCAATTCACTCGGTTACATTT pLKO_005 4038 CDS 100% 13.200 18.480 N SCN11A n/a
2 TRCN0000044615 CCTGTTCCATACAATATGAAT pLKO.1 1161 CDS 100% 5.625 7.875 N SCN11A n/a
3 TRCN0000413597 CATAAGTCTCATTATCCTAAA pLKO_005 4315 CDS 100% 10.800 7.560 N SCN11A n/a
4 TRCN0000044613 CCCTCATTAACTTAATGGAAT pLKO.1 3606 CDS 100% 4.950 3.465 N SCN11A n/a
5 TRCN0000044617 CGATGACATATTCAACTTCAA pLKO.1 4783 CDS 100% 4.950 3.465 N SCN11A n/a
6 TRCN0000044616 GCAGATGTAATGAACTGTGTA pLKO.1 2159 CDS 100% 4.950 3.465 N SCN11A n/a
7 TRCN0000044614 GCCTAGATAGTATGAAAGCAA pLKO.1 5295 CDS 100% 3.000 2.100 N SCN11A n/a
8 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 5878 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_014139.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.