Transcript: Human NM_014159.6

Homo sapiens SET domain containing 2, histone lysine methyltransferase (SETD2), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
SETD2 (29072)
Length:
8452
CDS:
54..7748

Additional Resources:

NCBI RefSeq record:
NM_014159.6
NBCI Gene record:
SETD2 (29072)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_014159.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000237837 AGTAGTGCTTCCCGTTATAAA pLKO_005 1701 CDS 100% 15.000 21.000 N SETD2 n/a
2 TRCN0000237838 ACGAATTAAAGACCGCAATAA pLKO_005 6377 CDS 100% 13.200 18.480 N SETD2 n/a
3 TRCN0000237835 TTCCGACGAGGGTCATCATAT pLKO_005 1668 CDS 100% 13.200 10.560 N SETD2 n/a
4 TRCN0000003029 CAGGGAGAACAGGCGTAATAA pLKO.1 2888 CDS 100% 15.000 10.500 N SETD2 n/a
5 TRCN0000237836 TGATAGCCATGATAGTATTAA pLKO_005 1982 CDS 100% 15.000 10.500 N SETD2 n/a
6 TRCN0000003030 CCTGAAGAATGATGAGATAAT pLKO.1 4877 CDS 100% 13.200 9.240 N SETD2 n/a
7 TRCN0000003033 CTTACCTGTCTGGAACTCATA pLKO.1 5307 CDS 100% 4.950 3.465 N SETD2 n/a
8 TRCN0000003032 GCCCTATGACTCTCTTGGTTA pLKO.1 6503 CDS 100% 4.950 3.465 N SETD2 n/a
9 TRCN0000003031 GCAAGTAAAGCCTGTCCTCAA pLKO.1 3414 CDS 100% 4.050 2.835 N SETD2 n/a
10 TRCN0000237839 CAGACCTGACTCCACTCTTAA pLKO_005 8002 3UTR 100% 13.200 7.920 N SETD2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_014159.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.