Transcript: Human NM_014206.4

Homo sapiens transmembrane protein 258 (TMEM258), mRNA.

Source:
NCBI, updated 2019-06-30
Taxon:
Homo sapiens (human)
Gene:
TMEM258 (746)
Length:
578
CDS:
42..281

Additional Resources:

NCBI RefSeq record:
NM_014206.4
NBCI Gene record:
TMEM258 (746)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_014206.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000188877 GTTCTTCGTTTACGAGGTCAC pLKO.1 146 CDS 100% 2.250 3.150 N TMEM258 n/a
2 TRCN0000158828 GATATCTATAAAGAGCTCCTC pLKO.1 186 CDS 100% 2.160 3.024 N TMEM258 n/a
3 TRCN0000352659 CCTCACTCTTCATGGGCTTTG pLKO_005 220 CDS 100% 6.000 4.200 N Tmem258 n/a
4 TRCN0000160130 CAAGTACACTCGTGATATCTA pLKO.1 173 CDS 100% 5.625 3.938 N TMEM258 n/a
5 TRCN0000189399 CTTAGTGGCCTCACTCTTCAT pLKO.1 212 CDS 100% 4.950 3.465 N TMEM258 n/a
6 TRCN0000188656 GTCACCTCTACCAAGTACACT pLKO.1 162 CDS 100% 3.000 2.100 N TMEM258 n/a
7 TRCN0000161780 CCAAGTACACTCGTGATATCT pLKO.1 172 CDS 100% 5.625 3.375 N TMEM258 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_014206.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00193 pDONR223 100% 100% 100% None n/a
Download CSV