Transcript: Human NM_014555.3

Homo sapiens transient receptor potential cation channel subfamily M member 5 (TRPM5), mRNA.

Source:
NCBI, updated 2019-08-04
Taxon:
Homo sapiens (human)
Gene:
TRPM5 (29850)
Length:
3946
CDS:
10..3507

Additional Resources:

NCBI RefSeq record:
NM_014555.3
NBCI Gene record:
TRPM5 (29850)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_014555.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000044873 CCTCGTCTATACCAACCTCAT pLKO.1 1983 CDS 100% 4.050 5.670 N TRPM5 n/a
2 TRCN0000044877 CTGATCCATATCTTTGCCATA pLKO.1 2554 CDS 100% 4.050 5.670 N TRPM5 n/a
3 TRCN0000417731 CACGTTGTGCACTGACCTTTG pLKO_005 3559 3UTR 100% 6.000 4.800 N TRPM5 n/a
4 TRCN0000044875 CCCTCTACTTCTGGGTCTTTA pLKO.1 2318 CDS 100% 13.200 9.240 N TRPM5 n/a
5 TRCN0000431506 CATCGTGGTAGAGCGCATGAT pLKO_005 2598 CDS 100% 4.950 3.465 N TRPM5 n/a
6 TRCN0000044874 GCATTTCTCTTGGGAGGACAT pLKO.1 876 CDS 100% 4.050 2.835 N TRPM5 n/a
7 TRCN0000044876 GTGAAGAAGTTCACACTGTAT pLKO.1 2395 CDS 100% 0.495 0.347 N TRPM5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_014555.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.