Transcript: Human NM_014681.6

Homo sapiens DExH-box helicase 34 (DHX34), mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
DHX34 (9704)
Length:
4338
CDS:
316..3747

Additional Resources:

NCBI RefSeq record:
NM_014681.6
NBCI Gene record:
DHX34 (9704)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_014681.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000236460 GGAGCACGGATTGTGAATAAA pLKO_005 3877 3UTR 100% 15.000 21.000 N DHX34 n/a
2 TRCN0000236459 GCCGACCAGGACAAGGTATTT pLKO_005 1573 CDS 100% 13.200 18.480 N DHX34 n/a
3 TRCN0000236457 GCGGCATCTCCACAACGATTT pLKO_005 1164 CDS 100% 10.800 15.120 N DHX34 n/a
4 TRCN0000064571 CACGGCATCCAAGATTCCTTA pLKO.1 3285 CDS 100% 4.950 6.930 N DHX34 n/a
5 TRCN0000064569 GCTTCGTAGTAGATTCCGGAA pLKO.1 1673 CDS 100% 2.160 3.024 N DHX34 n/a
6 TRCN0000236461 TCGCTCTTCTCCAGCTATTTC pLKO_005 1264 CDS 100% 13.200 9.240 N DHX34 n/a
7 TRCN0000236458 GATCCGCTTCGTAGTAGATTC pLKO_005 1668 CDS 100% 10.800 7.560 N DHX34 n/a
8 TRCN0000064570 CGAAAGGACTCAGACCAGATT pLKO.1 2779 CDS 100% 4.950 3.465 N DHX34 n/a
9 TRCN0000064568 GCAGAGATTCCAGAATCTCAA pLKO.1 516 CDS 100% 0.495 0.347 N DHX34 n/a
10 TRCN0000064572 CTGTTGCACTACCTGGACTTT pLKO.1 724 CDS 100% 4.950 2.970 N DHX34 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_014681.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.