Transcript: Human NM_014890.3

Homo sapiens filamin A interacting protein 1 like (FILIP1L), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-06
Taxon:
Homo sapiens (human)
Gene:
FILIP1L (11259)
Length:
3298
CDS:
248..2929

Additional Resources:

NCBI RefSeq record:
NM_014890.3
NBCI Gene record:
FILIP1L (11259)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_014890.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000433225 ATCCAGTCCATACTGATATTT pLKO_005 2944 3UTR 100% 15.000 21.000 N FILIP1L n/a
2 TRCN0000136993 CCATTGAAAGTCGGCTAGAAA pLKO.1 948 CDS 100% 5.625 7.875 N FILIP1L n/a
3 TRCN0000431196 CAGTGCCAAGCATGCGATATT pLKO_005 2602 CDS 100% 13.200 10.560 N FILIP1L n/a
4 TRCN0000136171 GCAATAGCTCAAGTGTGATAA pLKO.1 2673 CDS 100% 13.200 10.560 N FILIP1L n/a
5 TRCN0000136305 GCTAAGTACAAGTTAGCAGAA pLKO.1 1580 CDS 100% 0.405 0.324 N FILIP1L n/a
6 TRCN0000346916 TGATAACTACTGAGGATAATA pLKO_005 2688 CDS 100% 15.000 10.500 N Filip1l n/a
7 TRCN0000426994 ATGGCAACTGAAGACCTAATA pLKO_005 1715 CDS 100% 13.200 9.240 N FILIP1L n/a
8 TRCN0000137442 GCAGTCATCAATGGTCAGTTA pLKO.1 1988 CDS 100% 4.950 3.465 N FILIP1L n/a
9 TRCN0000136529 CCAATAAAGTCACCAGCAGTA pLKO.1 2838 CDS 100% 4.050 2.835 N FILIP1L n/a
10 TRCN0000136191 GCTTCAATCATTGGAAGCAAT pLKO.1 1300 CDS 100% 0.495 0.347 N FILIP1L n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_014890.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02661 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02661 pLX_304 0% 100% 100% V5 n/a
Download CSV