Transcript: Human NM_014931.4

Homo sapiens protein phosphatase 6 regulatory subunit 1 (PPP6R1), mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
PPP6R1 (22870)
Length:
3984
CDS:
590..3235

Additional Resources:

NCBI RefSeq record:
NM_014931.4
NBCI Gene record:
PPP6R1 (22870)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_014931.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000131019 CCTCAATGCTGACGATGAGAA pLKO.1 2377 CDS 100% 4.950 6.930 N PPP6R1 n/a
2 TRCN0000129846 CAGAGAGTCAAATAGAGAGAA pLKO.1 3461 3UTR 100% 4.950 3.960 N PPP6R1 n/a
3 TRCN0000129845 CCTACTTGAGATATGCTACAA pLKO.1 2410 CDS 100% 4.950 3.960 N PPP6R1 n/a
4 TRCN0000131150 GCTGGACCTCTTCTTCCATTA pLKO.1 1747 CDS 100% 10.800 7.560 N PPP6R1 n/a
5 TRCN0000130252 CCATTTGCACTGAGAAGAGAA pLKO.1 3408 3UTR 100% 4.950 3.465 N PPP6R1 n/a
6 TRCN0000128995 GCAGCTCTTAAGCAACATGTT pLKO.1 1336 CDS 100% 4.950 3.465 N PPP6R1 n/a
7 TRCN0000128818 GAGAGAATGGAGAGAGAGAAA pLKO.1 3475 3UTR 100% 4.950 2.970 N PPP6R1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_014931.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.