Transcript: Human NM_014949.4

Homo sapiens KH domain containing 4, pre-mRNA splicing factor (KHDC4), mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
KHDC4 (22889)
Length:
2961
CDS:
41..1885

Additional Resources:

NCBI RefSeq record:
NM_014949.4
NBCI Gene record:
KHDC4 (22889)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_014949.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000426106 AGACGAGATCAGCCGACTTAG pLKO_005 418 CDS 100% 10.800 15.120 N KHDC4 n/a
2 TRCN0000142264 GCTATACACAACCCTCTGCTA pLKO.1 1053 CDS 100% 2.640 3.696 N KHDC4 n/a
3 TRCN0000145054 CCCAGTTCTGACATAAAGAAA pLKO.1 2218 3UTR 100% 5.625 4.500 N KHDC4 n/a
4 TRCN0000142282 GAGCCATGATTATCCAGCCAA pLKO.1 1678 CDS 100% 2.640 2.112 N KHDC4 n/a
5 TRCN0000121825 GAGCTAAACAACAGATGCCAT pLKO.1 1848 CDS 100% 2.640 2.112 N KHDC4 n/a
6 TRCN0000431705 TTACTACTGTTTGGTCAATTT pLKO_005 2253 3UTR 100% 13.200 9.240 N KHDC4 n/a
7 TRCN0000141096 CCAGAACTGGTTGCAGCTAAA pLKO.1 2649 3UTR 100% 10.800 7.560 N KHDC4 n/a
8 TRCN0000121549 CTGGAGTTTGGGATACCAATA pLKO.1 1810 CDS 100% 10.800 7.560 N KHDC4 n/a
9 TRCN0000192226 CCACCATATTATCCATCCAAT pLKO.1 1094 CDS 100% 4.950 3.465 N 2810403A07Rik n/a
10 TRCN0000144106 CAAGATTAATGCCATGCTCAT pLKO.1 232 CDS 100% 4.050 2.835 N KHDC4 n/a
11 TRCN0000144881 GACTAATTTAGGTACAGGCTT pLKO.1 1498 CDS 100% 2.640 1.848 N KHDC4 n/a
12 TRCN0000142011 GCCCTTCTAAGATCCTGTCTT pLKO.1 2550 3UTR 100% 4.950 2.970 N KHDC4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_014949.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11643 pDONR223 100% 38.1% 37% None (many diffs) n/a
2 ccsbBroad304_11643 pLX_304 0% 38.1% 37% V5 (many diffs) n/a
Download CSV