Transcript: Human NM_014979.4

Homo sapiens synaptic vesicle glycoprotein 2C (SV2C), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
SV2C (22987)
Length:
10824
CDS:
232..2415

Additional Resources:

NCBI RefSeq record:
NM_014979.4
NBCI Gene record:
SV2C (22987)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_014979.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000152871 GCTTCTTAAATGCGCTATGCA pLKO.1 2246 CDS 100% 3.000 4.200 N SV2C n/a
2 TRCN0000152798 GTCCAAGGTTATGGCTTCTTT pLKO.1 943 CDS 100% 5.625 4.500 N SV2C n/a
3 TRCN0000157551 GATGACGAAGGCTCAAGTGAA pLKO.1 442 CDS 100% 4.950 3.960 N SV2C n/a
4 TRCN0000156436 CATTGCCAGAGAGGTGAAGAA pLKO.1 282 CDS 100% 4.950 3.465 N SV2C n/a
5 TRCN0000154052 CGGTTCCAAGATGAAGAAGAT pLKO.1 373 CDS 100% 4.950 3.465 N SV2C n/a
6 TRCN0000156763 GCAGACAAAGTGGGAAGGAAA pLKO.1 865 CDS 100% 4.950 3.465 N SV2C n/a
7 TRCN0000153350 GTGTTCTCGTACTTTGCTGAA pLKO.1 1015 CDS 100% 4.050 2.835 N SV2C n/a
8 TRCN0000165027 GAACTCCTGACCTCAAGTGAT pLKO.1 5854 3UTR 100% 4.950 2.475 Y LOC387873 n/a
9 TRCN0000341956 GAGAAGGTCTTCACGGTAAAT pLKO_005 1354 CDS 100% 13.200 18.480 N Sv2c n/a
10 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 7983 3UTR 100% 5.625 2.813 Y KLHL30 n/a
11 TRCN0000130146 CAGGTTCAAGTGATTCTCCTA pLKO.1 5725 3UTR 100% 2.640 1.320 Y DICER1-AS1 n/a
12 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 7983 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_014979.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07825 pDONR223 100% 99.9% 99.8% None 360G>A;1037T>C n/a
2 ccsbBroad304_07825 pLX_304 0% 99.9% 99.8% V5 360G>A;1037T>C n/a
Download CSV