Transcript: Human NM_015013.4

Homo sapiens lysine demethylase 1A (KDM1A), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-03
Taxon:
Homo sapiens (human)
Gene:
KDM1A (23028)
Length:
3013
CDS:
130..2688

Additional Resources:

NCBI RefSeq record:
NM_015013.4
NBCI Gene record:
KDM1A (23028)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_015013.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000046072 CCACGAGTCAAACCTTTATTT pLKO.1 1955 CDS 100% 15.000 21.000 N KDM1A n/a
2 TRCN0000327932 CCACGAGTCAAACCTTTATTT pLKO_005 1955 CDS 100% 15.000 21.000 N KDM1A n/a
3 TRCN0000046071 GCTACATCTTACCTTAGTCAT pLKO.1 1291 CDS 100% 4.950 6.930 N KDM1A n/a
4 TRCN0000327930 GCTACATCTTACCTTAGTCAT pLKO_005 1291 CDS 100% 4.950 6.930 N KDM1A n/a
5 TRCN0000382379 GGAGCTCCTGATTTGACAAAG pLKO_005 2813 3UTR 100% 10.800 8.640 N KDM1A n/a
6 TRCN0000046068 GCCTAGACATTAAACTGAATA pLKO.1 1871 CDS 100% 13.200 9.240 N KDM1A n/a
7 TRCN0000327856 GCCTAGACATTAAACTGAATA pLKO_005 1871 CDS 100% 13.200 9.240 N KDM1A n/a
8 TRCN0000046070 CCAACAATTAGAAGCACCTTA pLKO.1 834 CDS 100% 4.950 3.465 N KDM1A n/a
9 TRCN0000046069 GCTCCAATACTGTTGGCACTA pLKO.1 2227 CDS 100% 4.050 2.835 N KDM1A n/a
10 TRCN0000327857 GCTCCAATACTGTTGGCACTA pLKO_005 2227 CDS 100% 4.050 2.835 N KDM1A n/a
11 TRCN0000382249 AGGAAGGCTCTTCTAGCAATA pLKO_005 2739 3UTR 100% 10.800 6.480 N KDM1A n/a
12 TRCN0000379562 TGCCTCCTTTGAATGACCTAG pLKO_005 2839 3UTR 100% 4.050 2.430 N KDM1A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_015013.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14075 pDONR223 100% 85.6% 85.4% None 1_366del;1214C>A;2370A>N n/a
2 ccsbBroad304_14075 pLX_304 0% 85.6% 85.4% V5 1_366del;1214C>A;2370A>N n/a
Download CSV