Transcript: Human NM_015036.3

Homo sapiens endonuclease domain containing 1 (ENDOD1), mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
ENDOD1 (23052)
Length:
4651
CDS:
83..1585

Additional Resources:

NCBI RefSeq record:
NM_015036.3
NBCI Gene record:
ENDOD1 (23052)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_015036.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000253687 AGCGTAGCAAGAGTTACATTT pLKO_005 3078 3UTR 100% 13.200 18.480 N ENDOD1 n/a
2 TRCN0000265419 CAACCTTGAGGAGGCGATTAA pLKO_005 400 CDS 100% 13.200 18.480 N ENDOD1 n/a
3 TRCN0000253688 GTGTACACCATGGGCGCTATT pLKO_005 1406 CDS 100% 10.800 15.120 N ENDOD1 n/a
4 TRCN0000253689 GTTACCAAGCAGGTGATTAAT pLKO_005 1172 CDS 100% 15.000 10.500 N ENDOD1 n/a
5 TRCN0000265420 TGAAGAACGAATGGTACAATC pLKO_005 955 CDS 100% 10.800 7.560 N ENDOD1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_015036.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07833 pDONR223 100% 99.9% 99.8% None 1483G>T n/a
2 ccsbBroad304_07833 pLX_304 0% 99.9% 99.8% V5 1483G>T n/a
3 TRCN0000477094 GGAGTTACTATTCACATACCCATT pLX_317 18% 99.9% 99.8% V5 1483G>T n/a
Download CSV