Transcript: Human NM_015088.3

Homo sapiens trinucleotide repeat containing adaptor 6B (TNRC6B), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
TNRC6B (23112)
Length:
17950
CDS:
212..5383

Additional Resources:

NCBI RefSeq record:
NM_015088.3
NBCI Gene record:
TNRC6B (23112)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_015088.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000428730 CACAGATAGTGGGCCTTATTT pLKO_005 3436 CDS 100% 15.000 21.000 N TNRC6B n/a
2 TRCN0000121979 GCGCACTACATTTACTTCTTT pLKO.1 11349 3UTR 100% 5.625 7.875 N TNRC6B n/a
3 TRCN0000143799 GCAGGTTTACACATCTGCATT pLKO.1 13107 3UTR 100% 4.950 6.930 N TNRC6B n/a
4 TRCN0000124882 CCACAGTCAATTAGTCGGAAA pLKO.1 2849 CDS 100% 4.050 5.670 N Tnrc6b n/a
5 TRCN0000139185 CGATAACAACAGTGCCTCGAA pLKO.1 859 CDS 100% 2.640 3.696 N TNRC6B n/a
6 TRCN0000143491 GCTGAGTCAGACTGAAGATAA pLKO.1 3265 CDS 100% 13.200 9.240 N TNRC6B n/a
7 TRCN0000442864 TGGAACCGAGTCTCGCTTTAA pLKO_005 4051 CDS 100% 13.200 9.240 N TNRC6B n/a
8 TRCN0000124883 GCAACCACAAAGCAGGAAGTA pLKO.1 1938 CDS 100% 4.950 3.465 N Tnrc6b n/a
9 TRCN0000122414 GCCTCAATGCTCAAGCAGTTT pLKO.1 3596 CDS 100% 4.950 3.465 N TNRC6B n/a
10 TRCN0000144606 GCAATCAAATGAAGTCTGGAT pLKO.1 2229 CDS 100% 2.640 1.848 N TNRC6B n/a
11 TRCN0000256748 GGCAGGAGAATTGCTTGAATC pLKO_005 15382 3UTR 100% 10.800 5.400 Y SMIM11A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_015088.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.