Transcript: Human NM_015138.4

Homo sapiens RTF1 homolog, Paf1/RNA polymerase II complex component (RTF1), mRNA.

Source:
NCBI, updated 2019-05-04
Taxon:
Homo sapiens (human)
Gene:
RTF1 (23168)
Length:
5038
CDS:
13..2145

Additional Resources:

NCBI RefSeq record:
NM_015138.4
NBCI Gene record:
RTF1 (23168)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_015138.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000435618 GTTCGATTATCACGGCATAAG pLKO_005 1096 CDS 100% 10.800 15.120 N RTF1 n/a
2 TRCN0000022359 CCGAAACTCTTTATAGACTAT pLKO.1 4161 3UTR 100% 4.950 6.930 N RTF1 n/a
3 TRCN0000426881 GAACTGGGAAGAGACTCTAAA pLKO_005 2246 3UTR 100% 13.200 9.240 N RTF1 n/a
4 TRCN0000022362 GCTGAAAGTCACAACATGAAA pLKO.1 1753 CDS 100% 5.625 3.938 N RTF1 n/a
5 TRCN0000022361 CCGTTTAGAGTTTGTCTCAAA pLKO.1 1323 CDS 100% 4.950 3.465 N RTF1 n/a
6 TRCN0000022360 GCCAAACAAATCCAAGATCAA pLKO.1 1606 CDS 100% 4.950 3.465 N RTF1 n/a
7 TRCN0000022363 GCAAGAACTGTTCAATCGCAT pLKO.1 627 CDS 100% 2.640 1.848 N RTF1 n/a
8 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 3275 3UTR 100% 4.950 2.475 Y ERAP2 n/a
9 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 3276 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_015138.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.