Transcript: Human NM_015221.4

Homo sapiens dynamin binding protein (DNMBP), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-21
Taxon:
Homo sapiens (human)
Gene:
DNMBP (23268)
Length:
6428
CDS:
121..4854

Additional Resources:

NCBI RefSeq record:
NM_015221.4
NBCI Gene record:
DNMBP (23268)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_015221.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000281800 CGCTCTTTGTGGGAGATATTA pLKO_005 185 CDS 100% 15.000 21.000 N DNMBP n/a
2 TRCN0000271522 ATCCCTAAATCCGAGTAATTC pLKO_005 4380 CDS 100% 13.200 18.480 N DNMBP n/a
3 TRCN0000271521 TAGAAGTGTTTAGGGTCTTTA pLKO_005 5515 3UTR 100% 13.200 18.480 N DNMBP n/a
4 TRCN0000271519 TGTTTCAGATTCCGGAATATT pLKO_005 536 CDS 100% 15.000 12.000 N DNMBP n/a
5 TRCN0000148479 CTCCACAACCTAGCAAGTTAT pLKO.1 1615 CDS 100% 13.200 10.560 N DNMBP n/a
6 TRCN0000148251 CCGAATGCAAGAAAGATTGAT pLKO.1 3210 CDS 100% 5.625 4.500 N DNMBP n/a
7 TRCN0000271520 CTACGTTCCCTCCAATTATAT pLKO_005 4812 CDS 100% 15.000 10.500 N DNMBP n/a
8 TRCN0000149625 GCATCCCTAAATCCGAGTAAT pLKO.1 4378 CDS 100% 13.200 9.240 N DNMBP n/a
9 TRCN0000127834 GACCCTACAGAAGTAGTCAAT pLKO.1 1330 CDS 100% 4.950 3.465 N DNMBP n/a
10 TRCN0000127714 GAGGATCTCAAGTTCTGTGAA pLKO.1 2317 CDS 100% 4.950 3.465 N DNMBP n/a
11 TRCN0000127835 GCTGCTTGAAATCTACGAGAA pLKO.1 2754 CDS 100% 4.050 2.835 N DNMBP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_015221.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11710 pDONR223 100% 52% 52% None (many diffs) n/a
2 ccsbBroad304_11710 pLX_304 0% 52% 52% V5 (many diffs) n/a
Download CSV