Transcript: Human NM_015285.2

Homo sapiens WD repeat domain 7 (WDR7), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-02-17
Taxon:
Homo sapiens (human)
Gene:
WDR7 (23335)
Length:
7282
CDS:
212..4684

Additional Resources:

NCBI RefSeq record:
NM_015285.2
NBCI Gene record:
WDR7 (23335)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_015285.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000433633 GATTAGCTCCATGAGTATTAT pLKO_005 691 CDS 100% 15.000 21.000 N WDR7 n/a
2 TRCN0000426863 AGGATGTCACGACGGACAAAT pLKO_005 319 CDS 100% 13.200 18.480 N WDR7 n/a
3 TRCN0000413950 TGTTCGATGCCGGAGACTATT pLKO_005 930 CDS 100% 13.200 18.480 N WDR7 n/a
4 TRCN0000182958 CGATTGAAATTATTGCCCTTT pLKO.1 5134 3UTR 100% 4.050 5.670 N WDR7 n/a
5 TRCN0000182925 CCAATAGTAATGAACCTCTTA pLKO.1 1413 CDS 100% 4.950 3.960 N WDR7 n/a
6 TRCN0000180164 CGAGCACTGTTGTTTGGTCAT pLKO.1 380 CDS 100% 4.050 3.240 N WDR7 n/a
7 TRCN0000231263 CAGGATACTGAGCCAATATTT pLKO_005 806 CDS 100% 15.000 10.500 N Wdr7 n/a
8 TRCN0000430162 GTCATAATTTGGGACATATTT pLKO_005 1691 CDS 100% 15.000 10.500 N WDR7 n/a
9 TRCN0000182957 CCTTGAAGGATCTTTAGTTAA pLKO.1 4216 CDS 100% 13.200 9.240 N WDR7 n/a
10 TRCN0000429781 TGGATTGTTACCTCGGAAATA pLKO_005 776 CDS 100% 13.200 9.240 N WDR7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_015285.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11721 pDONR223 100% 53.2% 54.6% None (many diffs) n/a
2 ccsbBroad304_11721 pLX_304 0% 53.2% 54.6% V5 (many diffs) n/a
Download CSV