Transcript: Human NM_015306.3

Homo sapiens ubiquitin specific peptidase 24 (USP24), mRNA.

Source:
NCBI, updated 2019-07-06
Taxon:
Homo sapiens (human)
Gene:
USP24 (23358)
Length:
10800
CDS:
252..8114

Additional Resources:

NCBI RefSeq record:
NM_015306.3
NBCI Gene record:
USP24 (23358)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_015306.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000245776 ACAATACTGTGACCGTATAAA pLKO_005 1610 CDS 100% 15.000 21.000 N USP24 n/a
2 TRCN0000245777 TACACTTACCGGGAGTATTTA pLKO_005 2355 CDS 100% 15.000 21.000 N USP24 n/a
3 TRCN0000245779 CTCTCGTATGTAACGTATTTG pLKO_005 3481 CDS 100% 13.200 18.480 N USP24 n/a
4 TRCN0000245775 CCTTAGTGAGGCCGATCTTAA pLKO_005 10402 3UTR 100% 13.200 10.560 N USP24 n/a
5 TRCN0000245778 GAGCGCTATGTGATCACTATA pLKO_005 3045 CDS 100% 13.200 9.240 N USP24 n/a
6 TRCN0000040630 CCTCATTTCATGGACATCTTT pLKO.1 3109 CDS 100% 5.625 3.938 N Usp24 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_015306.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.