Transcript: Human NM_015307.1

Homo sapiens family with sequence similarity 189 member A1 (FAM189A1), mRNA.

Source:
NCBI, updated 2019-05-01
Taxon:
Homo sapiens (human)
Gene:
FAM189A1 (23359)
Length:
4718
CDS:
1..1620

Additional Resources:

NCBI RefSeq record:
NM_015307.1
NBCI Gene record:
FAM189A1 (23359)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_015307.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000240709 AGTGTGTGTAATGCTGAATTT pLKO_005 303 CDS 100% 13.200 9.240 N FAM189A1 n/a
2 TRCN0000240708 GGCTCGATGGCTCTATCATTA pLKO_005 2089 3UTR 100% 13.200 9.240 N FAM189A1 n/a
3 TRCN0000240707 TAGAAGGCTGCCAGTTGATTA pLKO_005 371 CDS 100% 13.200 9.240 N FAM189A1 n/a
4 TRCN0000240711 CTCAACGTCCTGTCCACTATC pLKO_005 547 CDS 100% 10.800 7.560 N FAM189A1 n/a
5 TRCN0000240710 GGTATGAAGGAGCCACATTTC pLKO_005 1614 CDS 100% 10.800 7.560 N FAM189A1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_015307.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11726 pDONR223 100% 52.3% 35.1% None (many diffs) n/a
2 ccsbBroad304_11726 pLX_304 0% 52.3% 35.1% V5 (many diffs) n/a
3 TRCN0000476081 ATATAGACGACCTATTACGTTTAC pLX_317 40.1% 52.3% 35.1% V5 (many diffs) n/a
Download CSV