Transcript: Human NM_015378.4

Homo sapiens vacuolar protein sorting 13 homolog D (VPS13D), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-21
Taxon:
Homo sapiens (human)
Gene:
VPS13D (55187)
Length:
16357
CDS:
168..13334

Additional Resources:

NCBI RefSeq record:
NM_015378.4
NBCI Gene record:
VPS13D (55187)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_015378.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000234636 TACAATCCGCAGGCCATTAAA pLKO_005 2076 CDS 100% 15.000 21.000 N VPS13D n/a
2 TRCN0000234639 CCAATCCCGAAGGTTACATTT pLKO_005 10447 CDS 100% 13.200 18.480 N VPS13D n/a
3 TRCN0000040287 CGGTTTGAAGACGCTGTGATT pLKO.1 12231 CDS 100% 4.950 6.930 N VPS13D n/a
4 TRCN0000234637 AGAGCAAGAGTCCCTTATTAA pLKO_005 3389 CDS 100% 15.000 10.500 N VPS13D n/a
5 TRCN0000234638 CACCCTTTCTGGAGATTATTA pLKO_005 8417 CDS 100% 15.000 10.500 N VPS13D n/a
6 TRCN0000234640 TTGTGAGGCAGGGAGTTATTT pLKO_005 13508 3UTR 100% 15.000 10.500 N VPS13D n/a
7 TRCN0000040283 CCCAGAAAGTTCCAGATCAAA pLKO.1 6272 CDS 100% 5.625 3.938 N VPS13D n/a
8 TRCN0000040285 CCCTTGAACATCATATACAAT pLKO.1 2061 CDS 100% 5.625 3.938 N VPS13D n/a
9 TRCN0000040286 GCCAGATTTGACTTCAAGAAA pLKO.1 7098 CDS 100% 5.625 3.938 N VPS13D n/a
10 TRCN0000040284 GCCTCGTGTATGAACACGTAT pLKO.1 1614 CDS 100% 0.495 0.347 N VPS13D n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_015378.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.