Transcript: Human NM_015562.2

Homo sapiens UBX domain protein 7 (UBXN7), mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
UBXN7 (26043)
Length:
10521
CDS:
29..1498

Additional Resources:

NCBI RefSeq record:
NM_015562.2
NBCI Gene record:
UBXN7 (26043)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_015562.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000253706 ATTCCGGCCACCCATTGATTT pLKO_005 451 CDS 100% 13.200 18.480 N UBXN7 n/a
2 TRCN0000253708 CCCTATGCTCATTTCGTATTT pLKO_005 2854 3UTR 100% 13.200 18.480 N UBXN7 n/a
3 TRCN0000253709 GACGGCCTGCACGTTCAATTT pLKO_005 330 CDS 100% 13.200 18.480 N UBXN7 n/a
4 TRCN0000253705 GGTGGAACCAGAACCATTATT pLKO_005 292 CDS 100% 15.000 10.500 N UBXN7 n/a
5 TRCN0000253707 TGCTTGAAGCGTGCAACAATA pLKO_005 129 CDS 100% 13.200 9.240 N UBXN7 n/a
6 TRCN0000165534 GAGACAGGGTTTCACCATGTT pLKO.1 5358 3UTR 100% 4.950 2.475 Y n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_015562.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.