Transcript: Human NM_015691.3

Homo sapiens WWC family member 3 (WWC3), mRNA.

Source:
NCBI, updated 2019-05-01
Taxon:
Homo sapiens (human)
Gene:
WWC3 (55841)
Length:
6463
CDS:
199..3477

Additional Resources:

NCBI RefSeq record:
NM_015691.3
NBCI Gene record:
WWC3 (55841)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_015691.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000281227 GCGAACGCTATGTGCTAAATT pLKO_005 3956 3UTR 100% 15.000 21.000 N WWC3 n/a
2 TRCN0000127968 GATTGTCCGTTCCCAGACATT pLKO.1 2907 CDS 100% 4.950 6.930 N WWC3 n/a
3 TRCN0000130817 GCTGACCGATAGCTTCAAGAA pLKO.1 717 CDS 100% 4.950 6.930 N WWC3 n/a
4 TRCN0000281155 GCTGACCGATAGCTTCAAGAA pLKO_005 717 CDS 100% 4.950 6.930 N WWC3 n/a
5 TRCN0000129701 CACTTCAGTTATACGTGTGTT pLKO.1 2252 CDS 100% 4.950 3.465 N WWC3 n/a
6 TRCN0000129101 CTACTTATGCAGCTGGAAGAA pLKO.1 1201 CDS 100% 4.950 3.465 N WWC3 n/a
7 TRCN0000128385 GAAGATCTCTTTCTGGAAGAA pLKO.1 2818 CDS 100% 4.950 3.465 N WWC3 n/a
8 TRCN0000129941 GCAATATGAAGAAGCCAGAAA pLKO.1 906 CDS 100% 4.950 3.465 N WWC3 n/a
9 TRCN0000281153 GCAATATGAAGAAGCCAGAAA pLKO_005 906 CDS 100% 4.950 3.465 N WWC3 n/a
10 TRCN0000130435 GCTGGTGTTTAACGAAGTGTT pLKO.1 2193 CDS 100% 4.950 3.465 N WWC3 n/a
11 TRCN0000281225 GCTGGTGTTTAACGAAGTGTT pLKO_005 2193 CDS 100% 4.950 3.465 N WWC3 n/a
12 TRCN0000128738 CAGACCTTTAGGGAGAAGATA pLKO.1 3400 CDS 100% 5.625 3.375 N WWC3 n/a
13 TRCN0000281154 CAGACCTTTAGGGAGAAGATA pLKO_005 3400 CDS 100% 5.625 3.375 N WWC3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_015691.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.