Transcript: Human NM_015719.4

Homo sapiens collagen type V alpha 3 chain (COL5A3), mRNA.

Source:
NCBI, updated 2019-09-26
Taxon:
Homo sapiens (human)
Gene:
COL5A3 (50509)
Length:
6207
CDS:
120..5357

Additional Resources:

NCBI RefSeq record:
NM_015719.4
NBCI Gene record:
COL5A3 (50509)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_015719.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000117051 CCTACTGGCTTAAAGGGTGAT pLKO.1 3087 CDS 100% 4.050 5.670 N COL5A3 n/a
2 TRCN0000422530 GGCTTTGAAGCCACCGTATTT pLKO_005 5418 3UTR 100% 13.200 10.560 N COL5A3 n/a
3 TRCN0000117049 CATTGGATTGATCGGTCTCAT pLKO.1 4331 CDS 100% 4.950 3.960 N COL5A3 n/a
4 TRCN0000117048 CCTGGACCTAAGGGATCTATT pLKO.1 2514 CDS 100% 13.200 9.240 N COL5A3 n/a
5 TRCN0000430957 AGACTTTCGAGGGAGACATTC pLKO_005 703 CDS 100% 10.800 7.560 N COL5A3 n/a
6 TRCN0000117050 CCCTGGACCTAAGGGATCTAT pLKO.1 2513 CDS 100% 5.625 3.938 N COL5A3 n/a
7 TRCN0000117047 CCTTTCTACTTCCACGGTGAA pLKO.1 5821 3UTR 100% 4.050 2.430 N COL5A3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_015719.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.