Transcript: Mouse NM_015733.5

Mus musculus caspase 9 (Casp9), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-18
Taxon:
Mus musculus (mouse)
Gene:
Casp9 (12371)
Length:
3899
CDS:
244..1608

Additional Resources:

NCBI RefSeq record:
NM_015733.5
NBCI Gene record:
Casp9 (12371)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_015733.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000012249 CGCGACATGATCGAGGATATT pLKO.1 352 CDS 100% 13.200 18.480 N Casp9 n/a
2 TRCN0000321027 CGCGACATGATCGAGGATATT pLKO_005 352 CDS 100% 13.200 18.480 N Casp9 n/a
3 TRCN0000012248 GCCCGGAATCACCAATCATTA pLKO.1 3105 3UTR 100% 13.200 18.480 N Casp9 n/a
4 TRCN0000321029 GCCCGGAATCACCAATCATTA pLKO_005 3105 3UTR 100% 13.200 18.480 N Casp9 n/a
5 TRCN0000012251 GCCAATGCTGTTTCTGCGAAA pLKO.1 1519 CDS 100% 4.050 5.670 N Casp9 n/a
6 TRCN0000320958 CCAACTTGGACCGTGACAAAC pLKO_005 905 CDS 100% 10.800 8.640 N Casp9 n/a
7 TRCN0000012252 CCACTGCCTCATCATCAACAA pLKO.1 840 CDS 100% 4.950 3.465 N Casp9 n/a
8 TRCN0000321028 CCACTGCCTCATCATCAACAA pLKO_005 840 CDS 100% 4.950 3.465 N Casp9 n/a
9 TRCN0000012250 CCTCATCATCAACAATGTGAA pLKO.1 846 CDS 100% 4.950 3.465 N Casp9 n/a
10 TRCN0000320959 AGAGGTTCTCAGACCAGAAAC pLKO_005 711 CDS 100% 10.800 6.480 N Casp9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_015733.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.