Transcript: Mouse NM_015748.3

Mus musculus slit homolog 1 (Drosophila) (Slit1), mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Slit1 (20562)
Length:
5300
CDS:
449..5044

Additional Resources:

NCBI RefSeq record:
NM_015748.3
NBCI Gene record:
Slit1 (20562)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_015748.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000106579 CCTGGAGTTGAACGGTATCAA pLKO.1 1393 CDS 100% 5.625 7.875 N Slit1 n/a
2 TRCN0000106577 CGCAAACTCTACTGTCTACAT pLKO.1 4466 CDS 100% 4.950 3.960 N Slit1 n/a
3 TRCN0000106578 CGGATCCACAAGAATGACTTT pLKO.1 671 CDS 100% 4.950 3.960 N Slit1 n/a
4 TRCN0000433294 AGAATGTCACAGAACTCTATT pLKO_005 2730 CDS 100% 13.200 9.240 N SLIT1 n/a
5 TRCN0000106575 CGACTGAACAACAATGAGATT pLKO.1 2084 CDS 100% 4.950 3.465 N Slit1 n/a
6 TRCN0000160522 CAACAACAAGATCAGTTCCTT pLKO.1 2824 CDS 100% 3.000 2.100 N SLIT1 n/a
7 TRCN0000106576 GCCAAGAAGTTTGAATGCCAA pLKO.1 3173 CDS 100% 2.640 1.848 N Slit1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_015748.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.