Transcript: Mouse NM_015773.2

Mus musculus sperm associated antigen 6-like (Spag6l), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Spag6l (50525)
Length:
2483
CDS:
145..1668

Additional Resources:

NCBI RefSeq record:
NM_015773.2
NBCI Gene record:
Spag6l (50525)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_015773.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000250353 TACGACGCACCTCCCAATATC pLKO_005 1408 CDS 100% 13.200 18.480 N Spag6l n/a
2 TRCN0000250352 CACTGTGAACAAAGCATATTT pLKO_005 1661 CDS 100% 15.000 10.500 N Spag6l n/a
3 TRCN0000250351 GGTTAGTGGCTGGACTATATG pLKO_005 1804 3UTR 100% 13.200 9.240 N Spag6l n/a
4 TRCN0000250350 TGTATCCAGGAGCCAGAAATT pLKO_005 667 CDS 100% 13.200 9.240 N Spag6l n/a
5 TRCN0000182089 CTTTGTATCCAGGAGCCAGAA pLKO.1 664 CDS 100% 4.050 2.835 N Spag6l n/a
6 TRCN0000181723 GCTGGACTATATGAAGGACAA pLKO.1 1812 3UTR 100% 4.050 2.835 N Spag6l n/a
7 TRCN0000250354 TGTTCGAGCAGTACCAGAAAG pLKO_005 170 CDS 100% 10.800 6.480 N Spag6l n/a
8 TRCN0000182525 GCAGTCGTGAAAGGTGACATT pLKO.1 376 CDS 100% 4.950 2.970 N Spag6l n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_015773.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.