Transcript: Mouse NM_015775.2

Mus musculus transmembrane protease, serine 2 (Tmprss2), mRNA.

Source:
NCBI, updated 2017-06-25
Taxon:
Mus musculus (mouse)
Gene:
Tmprss2 (50528)
Length:
3175
CDS:
231..1703

Additional Resources:

NCBI RefSeq record:
NM_015775.2
NBCI Gene record:
Tmprss2 (50528)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_015775.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000305036 ACGGGAACGTGACGGTATTTA pLKO_005 1645 CDS 100% 15.000 21.000 N Tmprss2 n/a
2 TRCN0000032151 CCCATCCAAATTACGACTCTA pLKO.1 1222 CDS 100% 4.950 6.930 N Tmprss2 n/a
3 TRCN0000303024 CCCATCCAAATTACGACTCTA pLKO_005 1222 CDS 100% 4.950 6.930 N Tmprss2 n/a
4 TRCN0000374513 GGCAACGTTGACCTCTATAAA pLKO_005 876 CDS 100% 15.000 10.500 N Tmprss2 n/a
5 TRCN0000032152 GCCGCTGGTTACTTTGAAGAA pLKO.1 1553 CDS 100% 4.950 3.465 N Tmprss2 n/a
6 TRCN0000303097 GCCGCTGGTTACTTTGAAGAA pLKO_005 1553 CDS 100% 4.950 3.465 N Tmprss2 n/a
7 TRCN0000032149 CCCTGGGTTTATACCAGGAAA pLKO.1 2761 3UTR 100% 0.495 0.347 N Tmprss2 n/a
8 TRCN0000032153 GCAAGCCTCAACATCTGTCAT pLKO.1 404 CDS 100% 4.950 2.970 N Tmprss2 n/a
9 TRCN0000303026 GCAAGCCTCAACATCTGTCAT pLKO_005 404 CDS 100% 4.950 2.970 N Tmprss2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_015775.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.