Transcript: Mouse NM_015780.2

Mus musculus complement factor H-related 1 (Cfhr1), mRNA.

Source:
NCBI, updated 2017-05-07
Taxon:
Mus musculus (mouse)
Gene:
Cfhr1 (50702)
Length:
1732
CDS:
65..1096

Additional Resources:

NCBI RefSeq record:
NM_015780.2
NBCI Gene record:
Cfhr1 (50702)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_015780.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000417252 TTCAGTCAGGAGAGGATATTG pLKO_005 954 CDS 100% 13.200 18.480 N Cfhr1 n/a
2 TRCN0000412454 ATACTACTCCTGTGAATATAA pLKO_005 232 CDS 100% 15.000 12.000 N Cfhr1 n/a
3 TRCN0000114082 CTGTTCTTAGTGGGAAGATTT pLKO.1 210 CDS 100% 13.200 9.240 N Cfhr1 n/a
4 TRCN0000422379 TGAAGAGGGCTGGTCCATTAC pLKO_005 469 CDS 100% 10.800 7.560 N Cfhr1 n/a
5 TRCN0000114084 GAAGTGTCTCAGGCTATGCTT pLKO.1 322 CDS 100% 3.000 2.100 N Cfhr1 n/a
6 TRCN0000114083 CCAAAGGTGAAGTGAGCCTTT pLKO.1 126 CDS 100% 0.405 0.284 N Cfhr1 n/a
7 TRCN0000114085 GTCACATCAATTATCCCACTT pLKO.1 1044 CDS 100% 4.050 2.430 N Cfhr1 n/a
8 TRCN0000255030 TATCAGTGCCAGAAGTATTAT pLKO_005 605 CDS 100% 15.000 7.500 Y Cfhr2 n/a
9 TRCN0000090508 GCTGGCCTCAAACTCAGAAAT pLKO.1 1209 3UTR 100% 13.200 6.600 Y Dync1li1 n/a
10 TRCN0000114081 CCAAGGACAAACTATGTCAAA pLKO.1 1475 3UTR 100% 4.950 2.475 Y Cfhr1 n/a
11 TRCN0000192337 CCAAGGACAAACTATGTCAAA pLKO.1 1475 3UTR 100% 4.950 2.475 Y Cfhr2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_015780.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.