Transcript: Mouse NM_015795.1

Mus musculus F-box protein 16 (Fbxo16), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Fbxo16 (50759)
Length:
1256
CDS:
121..1125

Additional Resources:

NCBI RefSeq record:
NM_015795.1
NBCI Gene record:
Fbxo16 (50759)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_015795.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000098961 CACTGACATCATCCGCTTTAA pLKO.1 798 CDS 100% 13.200 9.240 N Fbxo16 n/a
2 TRCN0000098962 CCAAGCTTCCAAGGGTGTTAT pLKO.1 389 CDS 100% 13.200 9.240 N Fbxo16 n/a
3 TRCN0000098964 ACTGCCGATGTTCAGCCAATT pLKO.1 652 CDS 100% 10.800 7.560 N Fbxo16 n/a
4 TRCN0000417042 CAAGCTTCCAAGGGTGTTATC pLKO_005 390 CDS 100% 10.800 7.560 N FBXO16 n/a
5 TRCN0000098960 CCACTGACATCATCCGCTTTA pLKO.1 797 CDS 100% 10.800 7.560 N Fbxo16 n/a
6 TRCN0000098963 ACCAGGTATTTGAAGAACGAA pLKO.1 215 CDS 100% 3.000 2.100 N Fbxo16 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_015795.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.