Transcript: Mouse NM_015820.3

Mus musculus heparan sulfate 6-O-sulfotransferase 3 (Hs6st3), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Hs6st3 (50787)
Length:
1784
CDS:
151..1563

Additional Resources:

NCBI RefSeq record:
NM_015820.3
NBCI Gene record:
Hs6st3 (50787)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_015820.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000103226 GCATCCAACGTGGACATCAAT pLKO.1 1297 CDS 100% 5.625 7.875 N Hs6st3 n/a
2 TRCN0000103225 CCTCCTTCTCTTGGATTACTT pLKO.1 1609 3UTR 100% 5.625 3.938 N Hs6st3 n/a
3 TRCN0000036359 CGTGGTCATCATGTACCAGTA pLKO.1 204 CDS 100% 4.050 2.835 N HS6ST3 n/a
4 TRCN0000103229 GAATTTCTACTACATCACGAT pLKO.1 855 CDS 100% 2.640 1.848 N Hs6st3 n/a
5 TRCN0000103227 GCAGCTTTATGAGTATGCGAA pLKO.1 1362 CDS 100% 2.640 1.848 N Hs6st3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_015820.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.