Transcript: Human NM_016154.5

Homo sapiens RAB4B, member RAS oncogene family (RAB4B), mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
RAB4B (53916)
Length:
1159
CDS:
130..771

Additional Resources:

NCBI RefSeq record:
NM_016154.5
NBCI Gene record:
RAB4B (53916)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_016154.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000381738 GGTCAGTGACGCGGAGTTATT pLKO_005 341 CDS 100% 13.200 6.600 Y RAB4B n/a
2 TRCN0000379712 GACTGTGAAGCTACAGATTTG pLKO_005 294 CDS 100% 10.800 5.400 Y RAB4B n/a
3 TRCN0000380533 GCACTATCCTCAACAAGATTG pLKO_005 629 CDS 100% 10.800 5.400 Y RAB4B n/a
4 TRCN0000381336 GCAGTGCAGGAACTGGCAAAT pLKO_005 173 CDS 100% 10.800 5.400 Y RAB4B n/a
5 TRCN0000380756 TCATTGAGAATAAGTTCAAAC pLKO_005 212 CDS 100% 10.800 5.400 Y RAB4B n/a
6 TRCN0000073024 CGCACTATCCTCAACAAGATT pLKO.1 628 CDS 100% 5.625 2.813 Y RAB4B n/a
7 TRCN0000380881 GATGGGCTCTGGCATTCAGTA pLKO_005 675 CDS 100% 4.950 2.475 Y RAB4B n/a
8 TRCN0000380038 GGTCATCCTCTGTGGCAACAA pLKO_005 474 CDS 100% 4.950 2.475 Y RAB4B n/a
9 TRCN0000380099 AGATTGACTCAGGCGAGCTAG pLKO_005 644 CDS 100% 4.050 2.025 Y RAB4B n/a
10 TRCN0000381059 CTCAAGTGTGCCCGCACTATC pLKO_005 616 CDS 100% 3.600 1.800 Y RAB4B n/a
11 TRCN0000073026 ACTGGCAAATCATGTCTCCTT pLKO.1 184 CDS 100% 2.640 1.320 Y RAB4B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_016154.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.